bioinformatic prediction tools Search Results


mirna-target prediction tool  (Applied Bioinformatics)
90
Applied Bioinformatics mirna-target prediction tool
Mirna Target Prediction Tool, supplied by Applied Bioinformatics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/mirna+target+prediction+tool/pmc07059292-79-24-12
Average 90 stars, based on 1 article reviews
mirna-target prediction tool - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
mapp epitope prediction tool  (Applied Bioinformatics)
90
Applied Bioinformatics mapp epitope prediction tool
Mapp Epitope Prediction Tool, supplied by Applied Bioinformatics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/mapp+epitope+prediction+tool/us12258594-250-20-36
Average 90 stars, based on 1 article reviews
mapp epitope prediction tool - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
bioinformatic prediction tools  (Rosetta Genomics)
90
Rosetta Genomics bioinformatic prediction tools
Bioinformatic Prediction Tools, supplied by Rosetta Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/bioinformatic+prediction+tools/pmc10971904-32-3-0
Average 90 stars, based on 1 article reviews
bioinformatic prediction tools - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
bioinformatics prediction tool program  (Proscan GmbH)
90
Proscan GmbH bioinformatics prediction tool program
Bioinformatics Prediction Tool Program, supplied by Proscan GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/bioinformatics+prediction+tool+program/10__1042_slash_bj20040522-140-3-2
Average 90 stars, based on 1 article reviews
bioinformatics prediction tool program - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
prediction bioinformatics tools  (Interactive Biosoftware)
90
Interactive Biosoftware prediction bioinformatics tools
a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b <t>Bioinformatics</t> analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.
Prediction Bioinformatics Tools, supplied by Interactive Biosoftware, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/prediction+bioinformatics+tools/pmc07608189-57-25-33
Average 90 stars, based on 1 article reviews
prediction bioinformatics tools - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
tools for gene predictions  (OnRamp BioInformatics)
90
OnRamp BioInformatics tools for gene predictions
a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b <t>Bioinformatics</t> analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.
Tools For Gene Predictions, supplied by OnRamp BioInformatics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/tools+for+gene+predictions/pmc07272004-110-9-0
Average 90 stars, based on 1 article reviews
tools for gene predictions - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
bioinformatic tools  (Predictive Biology)
90
Predictive Biology bioinformatic tools
a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b <t>Bioinformatics</t> analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.
Bioinformatic Tools, supplied by Predictive Biology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+prediction+tools/bioinformatic+tools/pm15037101-326-2-9
Average 90 stars, based on 1 article reviews
bioinformatic tools - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier

Image Search Results


a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b Bioinformatics analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.

Journal: European Journal of Human Genetics

Article Title: Biallelic PDE2A variants: a new cause of syndromic paroxysmal dyskinesia

doi: 10.1038/s41431-020-0641-9

Figure Lengend Snippet: a Multiple-sequence alignment showing the highly conserved Pro140 amino acid in the protein sequence encoded by the missense mutation c.446C>T; p.(Pro149Leu). b Bioinformatics analyses predicting a drastic decrease in the efficiency of the canonical donor splice site predicted to lead to exon 22 skipping. c Schematic representation of RT-PCR (primer sequence used for RT-PCR: EX21F1:5′CCACATGAAGGTCTCCGATG3′–EX23R1:5′GAGTTGTTTGTGCCTCTGTG3′) and nested PCR: Ex21-23F2:5′GCTGCCATTGACTCCAATTT3′–Ex24R2:5′CCTCGAGGTAGTTGGTGAGC3′) to evidence exon 22 skipping. d Sanger sequencing chromatograms of the amplified fragment confirming exon 22 skipping. e 1% gel electrophoresis initial RT-PCR products (left panel) and nested PCR products showing the amplification of the predicted fragment of about 184 bp only in the patient (blood: middle panel and fibroblast: right panel) bearing the variant and not in the control individual.

Article Snippet: To evaluate the potential pathogenicity impact of the C>T of the splice site variation on the efficiency of splicing, in silico analysis was performed using prediction bioinformatics tools available in Alamut ® Visual interactive biosoftware.

Techniques: Sequencing, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Nested PCR, Amplification, Nucleic Acid Electrophoresis, Variant Assay